Top » Catalog » I1 » A1515

$18.00

A1515
[A1515]

A1515
hg38 Position: ChrY:19063471..19063471
Ancestral: T
Derived: G
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Downstream Z140+ F2642+ Y1884/S2158+ [03] Branch
Forward Primer: A1515_F GGTGCCTCTGGTATGTCTGG
Reverse Primer: A1515_R TGAGGAGTTGCATGTGAGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies