Top » Catalog » I1 » A1520

$18.00

A1520
[A1520]

A1520
hg38 Position: ChrY:19070788..19070788
Ancestral: C
Derived: G
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Downstream Z140+ F2642+ Y1884/S2158+ [03] Branch
Forward Primer: A1520_F GCCAAACATACAATTCTAGTAAAGAAATATG
Reverse Primer: A1520_R TCTGGATGATGATGTAAACTTAAGATTG
Reviews

Customers who bought this product also purchased
A1351
A1351
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies