Top » Catalog » I1 » A1521

$18.00

A1521
[A1521]

A1521
hg38 Position: ChrY:19077369..19077369
Ancestral: G
Derived: T
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Downstream Z140+ F2642+ Y1884/S2158+ [03] Branch
Forward Primer: A1521_F GTTGCGGAGGACTACTGAGG
Reverse Primer: A1521_R TTCCGACACTTGGAAAGACC
Reviews

Customers who bought this product also purchased
A1347
A1347
A1522
A1522
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies