Top » Catalog » I1 » A1522

$18.00

A1522
[A1522]

A1522
hg38 Position: ChrY:19569870..19569870
Ancestral: T
Derived: G
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Downstream Z140+ F2642+ Y1884/S2158+ [03] Branch
Forward Primer: A1522_F TGGATAGCGTCCTTTGTCTC
Reverse Primer: A1522_R GCATTATTAAACTTGGGGATTG
Reviews

Customers who bought this product also purchased
A1347
A1347
A1521
A1521
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies