Top » Catalog » I1 » A1913

$18.00

A1913
[A1913]

A1913
hg38 Position: ChrY:8079628..8079628
Ancestral: G
Derived: C
Reference: William Hartley (2015)
ISOGG Haplogroup: I1a2a1 (not listed)
Comments: Below Z60
Forward Primer: A1913_F ACAGGTGTGAGGACATTTTGAG
Reverse Primer: A1913_R AGGAAAAACCACACCCAGTG
Reviews

Customers who bought this product also purchased
Z2539
Z2539
Z138
Z138
S19098
S19098
Z62
Z62
A6174
A6174
Z58
Z58
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A6240
1 x A754
$36.00
Haplogroup Info
Other products
Currencies