Top » Catalog » I1 » A7332

$18.00

A7332
[A7332]

A7332
hg38 Position: ChrY:4245278..4245278
Ancestral: T
Derived: C
Reference: William Hartley (2015)
ISOGG Haplogroup: I1a (not listed)
Comments: Below Z138 > S5619 > A6849
Forward Primer: A7332_F GGCTAAGCCATATAACTAATCAGTTTC
Reverse Primer: A7332_R TGCTTGTTAAATATCATGTAGGAAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies