Top » Catalog » I1 » A5924

$18.00

A5924
[A5924]

A5924
hg38 Position: ChrY:8005638..8005638
Ancestral: C
Derived: T
Reference: William Hartley (2015)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Downstream Z140 Z141+ Y6231+ Y6232+ Y6233+ [15] Branch
Forward Primer: A5924_F GAGTGTTGTAATCTTTTGTGCCTC
Reverse Primer: A5924_R AGACAGAGTATTGCTCTCTTGCC
Reviews

Customers who bought this product also purchased
Z62
Z62
FT2885
FT2885
A1994
A1994
Z2041
Z2041
Z138
Z138
Z58
Z58
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY20089
1 x FGC7387
1 x PH2328
1 x A14758
1 x Y12905
1 x FGC31164
$108.00
Haplogroup Info
Other products
Currencies