Top » Catalog » I1 » A9737

$18.00

A9737
[A9737]

A9737
hg38 Position: ChrY:15799799..15799799
Ancestral: G
Derived: C
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: Downstream I-A8100+ Z17925+ Z17928+
Forward Primer: A9737_F ATGGAGAAAGAGAATCCAGCC
Reverse Primer: A9737_R AGAAGTTGTTAAGAGGCATGGG
Reviews

Customers who bought this product also purchased
CTS6397
CTS6397
Z58
Z58
Z17937
Z17937
A9726
A9726
I1 Superclade Panel
I1 Superclade Panel
M253
M253
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y3640
1 x FGC8726
1 x VL63
1 x CTS4303
1 x M221
1 x CLD78
1 x BY120162
1 x L1365
$144.00
Haplogroup Info
Other products
Currencies