Top » Catalog » I1 » A6546

$18.00

A6546
[A6546]

A6546
hg38 Position: ChrY:7387665..7387665
Ancestral: C
Derived: T
Reference: William Hartley (2015)
ISOGG Haplogroup: I1a (not listed)
Comments: Downstream Z138 > Y16452
Forward Primer: A6546_F CATGACATCTCTCCAAGTGAGATC
Reverse Primer: A6546_R GCAAATGGACTGAAATACCTTATG
Reviews

Customers who bought this product also purchased
Z63
Z63
Y15902
Y15902
A18304
A18304
Z2336
Z2336
S6270
S6270
A6568
A6568
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies