Top » Catalog » I1 » A6546

$18.00

A6546
[A6546]

A6546
hg38 Position: ChrY:7387665..7387665
Ancestral: C
Derived: T
Reference: William Hartley (2015)
ISOGG Haplogroup: I1a (not listed)
Comments: Downstream Z138 > Y16452
Forward Primer: A6546_F CATGACATCTCTCCAAGTGAGATC
Reverse Primer: A6546_R GCAAATGGACTGAAATACCTTATG
Reviews

Customers who bought this product also purchased
Z140
Z140
A6756
A6756
Z2539
Z2539
A14738
A14738
Z58
Z58
S6277
S6277
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies