Top » Catalog » I1 » A10097

$18.00

A10097
[A10097]

A10097
hg38 Position: ChrY:15729728..15729728
Ancestral: A
Derived: G
Reference: William Hartley (2016)
ISOGG Haplogroup: I1a
Comments: Below DF29 > A5635
Forward Primer: A10097_F TTTGTGGCCATTCAGTTCTTC
Reverse Primer: A10097_R TGCTGCCTTTCTAAACAAACC
Reviews

Customers who bought this product also purchased
Z63
Z63
A5644
A5644
I1 Superclade Panel
I1 Superclade Panel
Y10633
Y10633
A10910
A10910
Y18697
Y18697
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A9344
$18.00
Haplogroup Info
Other products
Currencies