Top » Catalog » I1 » A9178

$18.00

A9178
[A9178]

A9178
hg38 Position: ChrY:14765390..14765390
Ancestral: G
Derived: T
Reference: William Hartley (2015)
ISOGG Haplogroup: I1b
Comments: Downstream M253+ Z131+ A8081+; peer to CTS6397
Forward Primer: A9178_F TGCAGGTTTGGATGTTATTG
Reverse Primer: A9178_R CAGAGTGTTAAGGGATGTTTTTG
Reviews

Customers who bought this product also purchased
CTS6868
CTS6868
DF29
DF29
CTS5510
CTS5510
L287
L287
Z63
Z63
A8792
A8792
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies