Top » Catalog » I1 » A8601

$18.00

A8601
[A8601]

A8601
hg38 Position: ChrY:14557539..14557539
Ancestral: A
Derived: C
Reference: William Hartley (2015)
ISOGG Haplogroup: I1 (not listed)
Comments: DownstreamZ140+ Z2535+ Y4015/FGC13287+ [04] Branch
Forward Primer: A8601_F AACCTCCCTGTGAGATCCTG
Reverse Primer: A8601_R AGCCCCAAATCCCACAATAC
Reviews

Customers who bought this product also purchased
I1 Superclade Panel
I1 Superclade Panel
Z2539
Z2539
A376
A376
Z140
Z140
A375
A375
S244
S244
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies