Top » Catalog » I1 » A681

$18.00

A681
[A681]

A681
hg38 Position: ChrY:7057260..7057260
Ancestral: A
Derived: C
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a1a1 (not listed)
Comments: Downstream of A376. Includes A264
Forward Primer: A681_F GGTGAGTGGTTTGGCTGAG
Reverse Primer: A681_R TGGTGCAGAGGCTCATAGAAC
Reviews

Customers who bought this product also purchased
A4600
A4600
A261
A261
I1-L338 Hamilton Group Panel
I1-L338 Hamilton Group Panel
S2000
S2000
A376
A376
A264
A264
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies