Top » Catalog » I1 » A681

$18.00

A681
[A681]

A681
hg38 Position: ChrY:7057260..7057260
Ancestral: A
Derived: C
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a1a1 (not listed)
Comments: Downstream of A376. Includes A264
Forward Primer: A681_F GGTGAGTGGTTTGGCTGAG
Reverse Primer: A681_R TGGTGCAGAGGCTCATAGAAC
Reviews

Customers who bought this product also purchased
A4600
A4600
S2000
S2000
A376
A376
A264
A264
A262
A262
A261
A261
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies