Top » Catalog » I1 » A6055

$18.00

A6055
[A6055]

A6055
hg38 Position: ChrY:17373560..17373560
Ancestral: A
Derived: G
Reference: William Hartley (2015)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Downstream F2642+ Y1884/FGC2491/S2158+ [02]. Observed in J1a-FGC11743 as well
Forward Primer: A6055_F TAAATGTCTGAATTGCACATTAAATGTC
Reverse Primer: A6055_R AGCAAAAATGCCACAAAGGAG
Reviews

Customers who bought this product also purchased
A6054
A6054
A6057
A6057
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies