Top » Catalog » I1 » A754

$18.00

A754
[A754]

A754
hg38 Position: ChrY:7367363..7367363
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: A754v2_F ACAAACTGAGAAATTACTGGCTGTT
Reverse Primer: A754v2_R AGAGGCAGTCCCTGTTCATAAG
Reviews

Customers who bought this product also purchased
A383
A383
A380
A380
DNA Sample Kit
DNA Sample Kit
A381
A381
A379
A379
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies