Top » Catalog » I1 » A755

$18.00

A755
[A755]

A755
hg38 Position: ChrY:12539868..12539868
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: A755_F CTTGGACTTGGTATTGCCTG
Reverse Primer: A755_R AACACCAAGAAACAGGCTCC
Reviews

Customers who bought this product also purchased
A378
A378
A381
A381
A825
A825
A827
A827
A756
A756
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies