Top » Catalog » I1 » A756

$18.00

A756
[A756]

A756
hg38 Position: ChrY:16583691..16583691
Ancestral: G
Derived: N
Reference: YSEQ (2016)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: A756_F GGGATGCAGGTAATTGATGG
Reverse Primer: A756_R TGAGGAGTCACCAGAAGGAGAG
Reviews

Customers who bought this product also purchased
A825
A825
A378
A378
A381
A381
A827
A827
A755
A755
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies