Top » Catalog » I1 » A17537

$18.00

A17537
[A17537]

A17537
hg38 Position: ChrY:7902342..7902342
Ancestral: C
Derived: A
Reference: Tony Popish (2017)
ISOGG Haplogroup: I1
Comments:
Forward Primer: A17537_F ACTTCCCAAGTGGTCACTGC
Reverse Primer: A17537_R TGCAGACTTTTTGCAAGTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies