Top » Catalog » I1 » A1830

$18.00

A1830
[A1830]

A1830
hg38 Position: ChrY:18950744..18950744
Ancestral: G
Derived: A
Reference: William Hartley (2015)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: DownstreamZ140+ Z2535+ S12289+ [02] Branch
Forward Primer: A1830_F CAGGATAGGTAGTCAAGGAAGTGACTATG
Reverse Primer: A1830_R CTGGGTGAAACAATGAGATTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies