Top » Catalog » I1 » A18239

$18.00

A18239
[A18239]

A18239
hg38 Position: ChrY:12703697..12703697
Ancestral: C
Derived: A
Reference: Perry Gillespie (2017)
ISOGG Haplogroup: I1
Comments:
Forward Primer: A18239_F ATAGAGATGGGATTTTAACATGTGAGG
Reverse Primer: A18239_R CTCTGTAAAAACATACCAATCACTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1818
1 x A13663
$36.00
Haplogroup Info
Other products
Currencies