Top » Catalog » I1 » A18241

$18.00

A18241
[A18241]

A18241
hg38 Position: ChrY:15083338..15083338
Ancestral: A
Derived: G
Reference: Perry Gillespie (2017)
ISOGG Haplogroup: I1
Comments:
Forward Primer: A18241_F TCATAGGCTTGTTGGCAGTG
Reverse Primer: A18241_R TCTTCAATATGGGGATTCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10255
1 x A1918
1 x A400
$54.00
Haplogroup Info
Other products
Currencies