Top » Catalog » I1 » A6561

$18.00

A6561
[A6561]

A6561
hg38 Position: ChrY:13097937..13097937
Ancestral: G
Derived: A
Reference: William Hartley (2015)
ISOGG Haplogroup: I1 (not listed)
Comments: Downstream Z138+
Forward Primer: A6561_F ACAGCAAGAAATCCCAATCC
Reverse Primer: A6561_R TTGCCCTAAGCAGTTTCCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies