Top » Catalog » I1 » A6588

$18.00

A6588
[A6588]

A6588
hg38 Position: ChrY:17346456..17346456
Ancestral: G
Derived: T
Reference: William Hartley (2015)
ISOGG Haplogroup: I1 (not listed)
Comments: Downstream Z138+
Forward Primer: A6588_F GAGGCTTTCATGTGGAGCTG
Reverse Primer: A6588_R GGTTACTCGCCTCATTGCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A6971
$18.00
Haplogroup Info
Other products
Currencies