Top » Catalog » I1 » A1379

$18.00

A1379
[A1379]

A1379
hg38 Position: ChrY:8025869..8025869
Ancestral: T
Derived: N
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Z140+[04] A140 A1373+ A1374+ Branch
Forward Primer: A1379_F CTCTGCCTAAAAAGGGCACC
Reverse Primer: A1379_R ACCTAGGCAATTGGCTTAGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies