Top » Catalog » I1 » A11270

$18.00

A11270
[A11270]

A11270
hg38 Position: ChrY:8649460..8649460
Ancestral: A
Derived: G
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: Downstream I1-F2642+ S2158+ A1346+
Forward Primer: A11270_F AGCAAAAGAGGGATGGATCTG
Reverse Primer: A11270_R AATACCATAGGGAGAGCCTGTAATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A262
1 x A9167
1 x A6235
$54.00
Haplogroup Info
Other products
Currencies