Top » Catalog » I1 » A825

$18.00

A825
[A825]

A825
hg38 Position: ChrY:16583839..16583839
Ancestral: G
Derived: T
Reference: Don Magnuson
ISOGG Haplogroup: I1 (not listed)
Comments: Aka Y7508
Forward Primer: A825_F TGTTTCTATAAAGGAATTCCTGAAGC
Reverse Primer: A825_R ACTCCAGCCTGGGCAATG
Reviews

Customers who bought this product also purchased
A381
A381
A756
A756
A378
A378
A755
A755
A827
A827
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies