Top » Catalog » I1 » A827

$18.00

A827
[A827]

A827
hg38 Position: ChrY:20755677..20755677
Ancestral: A
Derived: G
Reference: Don Magnuson
ISOGG Haplogroup: I1 (not listed)
Comments: Aka Y7507
Forward Primer: A827_F CCTATGTCCGAACTCGTCAAAC
Reverse Primer: A827_R AGCCAATCGTTAAGAAATAACCTG
Reviews

Customers who bought this product also purchased
A756
A756
A378
A378
A381
A381
A755
A755
A825
A825
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1365
$18.00
Haplogroup Info
Other products
Currencies