Top » Catalog » I1 » A826

$18.00

A826
[A826]

A826
hg38 Position: ChrY:20409064..20409064
Ancestral: T
Derived: C
Reference: Don Magnuson
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: A826_F GACACATGGTTTGGGGACTC
Reverse Primer: A826_R CACTGAGTCAAGGGCAAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies