Top » Catalog » I1 » A487

$18.00

A487
[A487]

A487
hg38 Position: ChrY:14848946..14848946
Ancestral: C
Derived: T
Reference: Tony Popish (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: A487_F AACACAGAGAAGGTTGAGAGTGC
Reverse Primer: A487_R ATTGGCTAGGAGCAGGTGTC
Reviews

Customers who bought this product also purchased
A485
A485
A491
A491
A484
A484
A490
A490
A481
A481
A489
A489
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies