Top » Catalog » I1 » A1329

$18.00

A1329
[A1329]

A1329
hg38 Position: ChrY:14428496..14428496
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: I1a2a1a2 (not listed)
Comments: I1 Z140 F2642 Y1884/S2158 Y2967 Y2963
Forward Primer: A1329_F CCTGCGCTGAGCTAGATTTC
Reverse Primer: A1329_R CCACGTCCTCACCAGAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies