Top » Catalog » I1 » A1346

$18.00

A1346
[A1346]

A1346
hg38 Position: ChrY:7168312..7168312
Ancestral: G
Derived: C
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Downstream Z140 F2642 Y1884/S2158
Forward Primer: A1346_F AGCCCTGGTAACCACAGATG
Reverse Primer: A1346_R AAGAGAAAAGATTGGGCTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies