Top » Catalog » I1 » A1347

$18.00

A1347
[A1347]

A1347
hg38 Position: ChrY:7268725..7268725
Ancestral: C
Derived: T
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Downstream Z140 F2642 Y1884/S2158
Forward Primer: A1347v2_F TGGTCTCAAACCTCTTACGTGAG
Reverse Primer: A1347v2_R CAACTGTCTAGAAGGAGGATATCAAATC
Reviews

Customers who bought this product also purchased
A1522
A1522
A1521
A1521
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies