Top » Catalog » I1 » A1350

$18.00

A1350
[A1350]

A1350
hg38 Position: ChrY:8786282..8786282
Ancestral: A
Derived: G
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Downstream Z140 F2642 Y1884/S2158
Forward Primer: A1350_F CCAGGAGGAAGAGTGCAGTG
Reverse Primer: A1350_R CTGTCCCAGTGGTCTGAAATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies