Top » Catalog » I1 » A1351

$18.00

A1351
[A1351]

A1351
hg38 Position: ChrY:9605968..9605968
Ancestral: C
Derived: A
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Downstream Z140 F2642 Y1884/S2158
Forward Primer: A1351_F GAGGTTAAGTGTAGTTTTTCAGGTCC
Reverse Primer: A1351_R CCTTATATGTTGAGATTCTGAGGGTC
Reviews

Customers who bought this product also purchased
A1520
A1520
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies