Top » Catalog » I1 » A1356

$18.00

A1356
[A1356]

A1356
hg38 Position: ChrY:14730460..14730460
Ancestral: G
Derived: A
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Downstream Z140 F2642 Y1884/S2158
Forward Primer: A1356_F TAGGCAGGTGGATCAGGATG
Reverse Primer: A1356_R ACAGAGTGGAATAGACACTGGAG
Reviews

Customers who bought this product also purchased
A1354
A1354
A1358
A1358
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies