Top » Catalog » I1 » A1362

$18.00

A1362
[A1362]

A1362
hg38 Position: ChrY:17130814..17130814
Ancestral: C
Derived: T
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Downstream Z140 F2642 Y1884/S2158
Forward Primer: A1362_F CCACAGCTTTCAGCTTTTCC
Reverse Primer: A1362_R GGAGTTTTTGTAGGGGCAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies