Top » Catalog » I1 » A1363

$18.00

A1363
[A1363]

A1363
hg38 Position: ChrY:19068150..19068150
Ancestral: C
Derived: G
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Downstream Z140 F2642 Y1884/S2158
Forward Primer: A1363_F AAACACCACTAAGTCTTCACAACTTG
Reverse Primer: A1363_R TCATCCAGGTGTGCTGTCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies