Top » Catalog » I1 » A1364

$18.00

A1364
[A1364]

A1364
hg38 Position: ChrY:20812054..20812054
Ancestral: T
Derived: C
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Downstream Z140 F2642 Y1884/S2158
Forward Primer: A1364_F CAAAAGTGTTTCCTTCCGAGTC
Reverse Primer: A1364_R GCCCAATTACCAGGCCG
Reviews

Customers who bought this product also purchased
A1349
A1349
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies