Top » Catalog » I1 » A1365

$18.00

A1365
[A1365]

A1365
hg38 Position: ChrY:21091623..21091623
Ancestral: T
Derived: G
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Downstream Z140 F2642 Y1884/S2158
Forward Primer: A1365_F CGTACTGACTGGGAAGTTAGTATGTATTG
Reverse Primer: A1365_R GAGTTTTGCATGACTTACATGCC
Reviews

Customers who bought this product also purchased
A1366
A1366
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies