Top » Catalog » I1 » A1360

$18.00

A1360
[A1360]

A1360
hg38 Position: ChrY:16777838..16777838
Ancestral: G
Derived: A
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Downstream Z140 F2642 Y1884/S2158
Forward Primer: A1360v2_F GACAGATATTTATGTTGATTTTGCATG
Reverse Primer: A1360v2_R GCAACCTTGAGAGGAGACACC
Reviews

Customers who bought this product also purchased
A1359
A1359
A1353
A1353
A1355
A1355
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies