Top » Catalog » I1 » A1361

$18.00

A1361
[A1361]

A1361
hg38 Position: ChrY:16955302..16955302
Ancestral: G
Derived: A
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Downstream Z140 F2642 Y1884/S2158
Forward Primer: A1361_F TGGTCCACAGTTGCGATG
Reverse Primer: A1361_R GGGGGTTGCTTAATAACCTTG
Reviews

Customers who bought this product also purchased
FGC33557
FGC33557
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies