Top » Catalog » I1 » A1361

$18.00

A1361
[A1361]

A1361
hg38 Position: ChrY:16955302..16955302
Ancestral: G
Derived: A
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Downstream Z140 F2642 Y1884/S2158
Forward Primer: A1361_F TGGTCCACAGTTGCGATG
Reverse Primer: A1361_R GGGGGTTGCTTAATAACCTTG
Reviews

Customers who bought this product also purchased
FGC33557
FGC33557
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies