Top » Catalog » I1 » A1373

$18.00

A1373
[A1373]

A1373
hg38 Position: ChrY:11517159..11517159
Ancestral: A
Derived: G
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Downstream Z140
Forward Primer: A1373_F ACTCGAATGGAATGGAAACC
Reverse Primer: A1373_R ATTCCATCGCTCTACCATCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies