Top » Catalog » I1 » A1374

$18.00

A1374
[A1374]

A1374
hg38 Position: ChrY:20868313..20868313
Ancestral: T
Derived: C
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Downstream Z140
Forward Primer: A1374_F GCACCCACTTTCCAACACTAC
Reverse Primer: A1374_R ACAGTGAATCCCCAGGACAC
Reviews

Customers who bought this product also purchased
Z140
Z140
Y6231
Y6231
Z2539
Z2539
A196
A196
Z62
Z62
F2642
F2642
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies