Top » Catalog » I1 » A1374

$18.00

A1374
[A1374]

A1374
hg38 Position: ChrY:20868313..20868313
Ancestral: T
Derived: C
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Downstream Z140
Forward Primer: A1374_F GCACCCACTTTCCAACACTAC
Reverse Primer: A1374_R ACAGTGAATCCCCAGGACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies