Top » Catalog » I1 » A1377

$18.00

A1377
[A1377]

A1377
hg38 Position: ChrY:7473868..7473868
Ancestral: C
Derived: A
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a2 (not listed)
Comments: Downstream F2642 Y1884/S2158 Y2967 Y2963
Forward Primer: A1377v2_F GTTATTACCCTGAGAAAAATAGACACAAC
Reverse Primer: A1377v2_R CCTCCAGGACTGTGGGAGAC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies