Top » Catalog » I1 » A6867

$18.00

A6867
[A6867]

A6867
hg38 Position: ChrY:13932008..13932008
Ancestral: T
Derived: G
Reference: William Hartley (2015)
ISOGG Haplogroup: I1a2b
Comments: Downstream Z138
Forward Primer: A6867_F GCAGGAAGGTTTATGAAACGTG
Reverse Primer: A6867_R TTTCAATCAAACAGTTTATTGCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies