Top » Catalog » I1 » A263

$18.00

A263
[A263]

A263
hg38 Position: ChrY:12723399..12723399
Ancestral: T
Derived: A
Reference: Ken Nordtvedt (2014)
ISOGG Haplogroup: I1a2a1a1a1 (not listed)
Comments: Downstream L338+ AS1H. SNP is in the intersection between a pentarepeat STR and a homopolymer
Forward Primer: A263_F TTACTCTCAGCCACAAGTAAAAGCTTTGG
Reverse Primer: A263_R GAGAATGGCATGAACCAGGAGGCGA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A489
1 x Y29577
1 x A7452
1 x A18842
1 x F4325
1 x A1839
1 x R1a-L1029 Dibra Cluster
1 x VL18
1 x A19323
1 x Y54236
1 x FGC4420
1 x BY10613
1 x A280
$332.00
Haplogroup Info
Other products
Currencies