Top » Catalog » I1 » A263

$18.00

A263
[A263]

A263
hg38 Position: ChrY:12723399..12723399
Ancestral: T
Derived: A
Reference: Ken Nordtvedt (2014)
ISOGG Haplogroup: I1a2a1a1a1 (not listed)
Comments: Downstream L338+ AS1H. SNP is in the intersection between a pentarepeat STR and a homopolymer
Forward Primer: A263_F TTACTCTCAGCCACAAGTAAAAGCTTTGG
Reverse Primer: A263_R GAGAATGGCATGAACCAGGAGGCGA
Reviews

Customers who bought this product also purchased
A264
A264
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies