Top » Catalog » I2 » A2228

$18.00

A2228
[A2228]

A2228
hg38 Position: ChrY:8607746..8607746
Ancestral: T
Derived: A
Reference: Richard Gillespie (2015)
ISOGG Haplogroup: I2 (not listed)
Comments: Below L126 > S7753/Y4171 > Y4751 > Y4750 > A824
Forward Primer: A2228_F AGGCAGGATAACATTTCTGACTG
Reverse Primer: A2228_R CACAAGGAAAACAGGCAGGTTTTG
Reviews

Customers who bought this product also purchased
A11612
A11612
A5860
A5860
A824
A824
L126
L126
Y11858
Y11858
I2a-M284 Panel
I2a-M284 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies