Top » Catalog » I2 » A2229

$18.00

A2229
[A2229]

A2229
hg38 Position: ChrY:14122569..14122569
Ancestral: A
Derived: G
Reference: Richard Gillespie (2015)
ISOGG Haplogroup: I2 (not listed)
Comments: Below L126 > S7753/Y4171 > Y4751 > Y4750 > A824
Forward Primer: A2229_F CTACAAGCATTTCAAGGTGCAG
Reverse Primer: A2229_R TCATTTCTTTGATGAAAGCAAATG
Reviews

Customers who bought this product also purchased
A2239
A2239
A2230
A2230
A2228
A2228
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies